MCQ Questions Class 12 Molecular Basis of Inheritance With Answers

CBSE Class 12 Molecular Basis of Inheritance Multiple Choice Questions with Answers. MCQ Questions Class 12 Molecular Basis of Inheritance with Answers Is Prepared Based on Latest Exam Pattern. Students can solve NCERT MCQ questions Class 12 Molecular Basis of Inheritance with Answers to know their preparation level.

Students who are searching for NCERT MCQ Questions Class 12 Molecular Basis of Inheritance with Answers are compiled here to get good practice on all fundamentals. Know your preparation level on MCQ Questions for Class 12 Molecular Basis of Inheritance with Answers. You can also verify your answers from the provided MCQ Class 12 Molecular Basis of Inheritance with Answers. So, ace up your preparation with MCQ of Class 12 Biology Examinations.

MCQ Questions Class 12 Molecular Basis of Inheritance with Answers - Set - 5

Question 1: 

Experimental material in the study of DNA replication has been
(a) Escherichia coli
(b) Neurospora crassa
(c) Pneumococcus
(d) Drosophila melanogaster.

Correct Answer – (A)

Question 2: 

Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG

Correct Answer – (B)

Question 3: 

Teminism is
a) a central dogma reverse
b) a central dogma of molecular biology
c) a circular flow of hereditary material
d) an effect of cytoplasm on functioning of DNA

Correct Answer – (A)

Question 4: 

In a nucleotide, the nitrogen base is joined to the sugar molecule by
a) Phosphodiester bond
b) Glycosidic bond
c) Hydrogen bond
d) Both (a) & (b)

Correct Answer – (B)

Question 5: 

Cistron is
a) The coding sequence of DNA
b) The functional unit of DNA molecule that codes for a particular gene product
c) Intervening non coding sequence of DNA
d) The sequences which are removed during RNA splicing

Correct Answer – (B)

MCQ Questions Class 12 Molecular Basis of Inheritance With Answers

Question 6: 

‘Lac operon’ in E. coli, is induced by
(a) ‘I’ gene
(b) promoter gene
(c) β-galactosidase
(d) lactose.

Correct Answer – (C)

Question 7: 

Peptidyl transferase
a) Is a 23s rRNA
b) forms peptide bonds
c) component of ribosome
d) all the three

Correct Answer – (D)

Question 8: 

Sickle cell anemia is caused
a) When valine is replaced by glutamic acid in beta polypeptide chain
b) When glutamic acid is replaced by valine in beta polypeptide chain
c) When glutamic acid is replaced by valine in alpha polypeptide chain
d) When valine is replaced by glutamic acid in alpha polypeptide chain

Correct Answer – (B)

Question 9: 

Read the statements given below and identify the incorrect statement.
a) The human genome contains 3164.7 million nucleotide bases.
b) The average gene consists of 30,000 bp
c) The total number of genes is estimated at 30,000.
d) Chromosome Y has 231 genes

Correct Answer – (B)

Question 10: 

If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA
a) 30%
b) 10%
c) 90%
d) 40%

Correct Answer – (A)
MCQ Questions Class 12 Molecular Basis of Inheritance With Answers
MCQ Questions Class 12 Principles of Inheritance and Variation With Answers
MCQ Questions Mechanical Engineering Machine Design

Leave a Reply

Related Post

Semiconductor Electronics Materials Devices and Simple Circuits-1

MCQ Questions Class 12 Semiconductor Electronics Materials Devices and Simple Circuits With Answers

CBSE Class 12 Semiconductor Electronics Materials Devices and Simple Circuits Multiple Choice Questions with Answers. MCQ Questions Class 12 Semiconductor Electronics Materials Devices and Simple Circuits with Answers Is Prepared Based on Latest Exam Pattern. Students can solve NCERT Class 12 Semiconductor Electronics Materials Devices and Simple Circuits MCQs with Answers to know their preparation level. Students […]

hydrogen-3

MCQ Questions Class 11 Chemistry Hydrogen with Answers

CBSE Class 11 Chemistry Chapter 9 Hydrogen Multiple Choice Questions with Answers. MCQ Questions Class 11 Chemistry Hydrogen with Answers was Prepared Based on Latest Exam Pattern. Students can solve NCERT Class 11 Chemistry Hydrogen MCQs with Answers to know their preparation level. Students who are searching for NCERT MCQ Questions for Class 11 Chemistry Hydrogen with Answers are […]

Relations and Functions-2

MCQ Questions Class 12 Relations and Functions With Answers

CBSE Class 12 Relations and Functions Multiple Choice Questions with Answers. MCQ Questions Class 12 Relations and Functions with Answers Is Prepared Based on Latest Exam Pattern. Students can solve NCERT MCQ questions Class 12 Relations and Functions with Answers to know their preparation level. Students who are searching for NCERT MCQ Questions Class 12 Relations and […]