CBSE Class 12 Molecular Basis of Inheritance Multiple Choice Questions with Answers. MCQ Questions Class 12 Molecular Basis of Inheritance with Answers Is Prepared Based on Latest Exam Pattern. Students can solve NCERT MCQ questions Class 12 Molecular Basis of Inheritance with Answers to know their preparation level.
Students who are searching for NCERT MCQ Questions Class 12 Molecular Basis of Inheritance with Answers are compiled here to get good practice on all fundamentals. Know your preparation level on MCQ Questions for Class 12 Molecular Basis of Inheritance with Answers. You can also verify your answers from the provided MCQ Class 12 Molecular Basis of Inheritance with Answers. So, ace up your preparation with MCQ of Class 12 Biology Examinations.
MCQ Questions Class 12 Molecular Basis of Inheritance with Answers - Set - 5
Question 1:
Experimental material in the study of DNA replication has been
(a) Escherichia coli
(b) Neurospora crassa
(c) Pneumococcus
(d) Drosophila melanogaster.
Correct Answer – (A)
Question 2:
Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG
Correct Answer – (B)
Question 3:
Teminism is
a) a central dogma reverse
b) a central dogma of molecular biology
c) a circular flow of hereditary material
d) an effect of cytoplasm on functioning of DNA
Correct Answer – (A)
Question 4:
In a nucleotide, the nitrogen base is joined to the sugar molecule by
a) Phosphodiester bond
b) Glycosidic bond
c) Hydrogen bond
d) Both (a) & (b)
Correct Answer – (B)
Question 5:
Cistron is
a) The coding sequence of DNA
b) The functional unit of DNA molecule that codes for a particular gene product
c) Intervening non coding sequence of DNA
d) The sequences which are removed during RNA splicing
Correct Answer – (B)
MCQ Questions Class 12 Molecular Basis of Inheritance With Answers
Question 6:
‘Lac operon’ in E. coli, is induced by
(a) ‘I’ gene
(b) promoter gene
(c) β-galactosidase
(d) lactose.
Correct Answer – (C)
Question 7:
Peptidyl transferase
a) Is a 23s rRNA
b) forms peptide bonds
c) component of ribosome
d) all the three
Correct Answer – (D)
Question 8:
Sickle cell anemia is caused
a) When valine is replaced by glutamic acid in beta polypeptide chain
b) When glutamic acid is replaced by valine in beta polypeptide chain
c) When glutamic acid is replaced by valine in alpha polypeptide chain
d) When valine is replaced by glutamic acid in alpha polypeptide chain
Correct Answer – (B)
Question 9:
Read the statements given below and identify the incorrect statement.
a) The human genome contains 3164.7 million nucleotide bases.
b) The average gene consists of 30,000 bp
c) The total number of genes is estimated at 30,000.
d) Chromosome Y has 231 genes
Correct Answer – (B)
Question 10:
If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA
a) 30%
b) 10%
c) 90%
d) 40%
Correct Answer – (A)
- NCERT Solutions Class 11 Chemistry Chapter 1 : Some Basic Concepts of Chemistry
- NCERT Solutions Class 11 Chemistry Chapter 2 : Structure Of The Atom
- NCERT Solutions Class 11 Chemistry Chapter 3 : Classification of Elements and Periodicity in Properties
- NCERT Solutions Class 11 Chemistry Chapter 4 : Chemical Bonding and Molecular Structure
- NCERT Solutions Class 11 Chemistry Chapter 5 : States of Matter
- NCERT Solutions Class 11 Chemistry Chapter 6 : Thermodynamics
- NCERT Solutions Class 11 Chemistry Chapter 7 : Equilibrium
- NCERT Solutions Class 11 Chemistry Chapter 8 : Redox Reactions
- NCERT Solutions Class 11 Chemistry Chapter 9 : Hydrogen
- NCERT Solutions Class 11 Chemistry Chapter 10 : The s-Block Elements
- NCERT Solutions Class 11 Chemistry Chapter 11 : The p-Block Elements
- NCERT Solutions Class 11 Chemistry Chapter 12 : Organic Chemistry: Some Basic Principles and Techniques
- NCERT Solutions Class 11 Chemistry Chapter 13 : Hydrocarbons
- NCERT Solutions Class 11 Chemistry Chapter 14 : Environmental Chemistry





